Thermo Scientific™

T7 promoter Sequencing Primer, 20-mer

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5- and 3-hydroxyl ends. The primers are complementary to the자세히 알아보기

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5- and 3-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Promoter sequences 5-d (TAATACGACTCACTATAGGG)-3

Related products
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T3 promoter Sequencing Primer, 24-mer
SP6 promoter Sequencing Primer, 18-mer

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.

사양

프로모터SP6, T3, T7

제품 유형Sequencing Primer

배송 조건Dry Ice

농도10 μM

PrimerT7

수량10 μM

벡터pTZ19R, pTZ57R, pBluescript II

용도(애플리케이션)Sequencing

형태Liquid

Unit Size10 µM