Thermo Fisher Scientific T7 promoter Sequencing Primer, 20-mer
상품 옵션 정보 | |||||||||
---|---|---|---|---|---|---|---|---|---|
카탈로그 번호 | CAS 번호 | 설명 | 상태 | 재고 | 단위 | 판매가 | 할인가 | 가격(VAT포함) | 수량 / 장바구니 / 찜 |
SO118 | - | Thermo Fisher Scientific SO118 T7 promoter Sequencing Primer, 20-mer 10 uM pk | 재고문의 | pk | 68,000원 | - | 74,800원 |
다른 상품 둘러보기
Thermo Scientific™
T7 promoter Sequencing Primer, 20-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5- and 3
-hydroxyl ends. The primers are complementary to the자세히 알아보기
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5- and 3
-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II
Promoter sequences 5-d (TAATACGACTCACTATAGGG)-3
Related products
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T3 promoter Sequencing Primer, 24-mer
SP6 promoter Sequencing Primer, 18-mer
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.
사양
프로모터SP6, T3, T7
제품 유형Sequencing Primer
배송 조건Dry Ice
농도10 μM
PrimerT7
수량10 μM
벡터pTZ19R, pTZ57R, pBluescript II
용도(애플리케이션)Sequencing
형태Liquid
Unit Size10 µM
배송/결제/교환/반품 안내
배송 정보
기본 배송비 |
| 교환/반품 배송비 |
|
---|---|---|---|
착불 배송비 |
| ||
교환/반품 배송비 |
|
결제 및 환불 안내
결제 방법 |
|
---|---|
취소 |
|
반품 |
|
환급 |
|
교환 및 반품 접수
교환 및 반품 접수 기한 |
|
---|---|
교환 및 반품 접수가 가능한 경우 |
|
교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
교환 절차 |
|
---|---|
반품 절차 |
|