Thermo Scientific™

pJET1.2 Forward Sequencing Primer, 23-mer

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5-hydroxyl and 3-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in자세히 알아보기

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5-hydroxyl and 3-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5-d(CGACTCACTATAGGGAGAGCGGC)-3
• pJET1.2 reverse sequencing primer, 24-mer: 5-d(AAGAACATCGATTTTCCATGGCAG)-3

Related products
pJET1.2 Reverse Sequencing Primer, 24-mer

사양

제품 유형Forward Sequencing Primer

배송 조건Dry Ice

농도10 μM

PrimerpJET

수량10 μM

벡터pJET1.2

용도(애플리케이션)Sequencing

형태Liquid

Unit Size10 µM