Thermo Fisher Scientific pJET1.2 Forward Sequencing Primer, 23-mer
상품 옵션 정보 | ||||||||
---|---|---|---|---|---|---|---|---|
카탈로그 번호 | CAS 번호 | 설명 | 상태 | 단위 | 판매가 | 할인가 | 가격(VAT포함) | 수량 / 장바구니 / 찜 |
SO501 | - | Thermo Fisher Scientific SO501 pJET1.2 Forward Sequencing Primer, 23-mer 10 uM pk | 재고문의 | pk | 78,000원 | - | 85,800원 |
다른 상품 둘러보기
Thermo Scientific™
pJET1.2 Forward Sequencing Primer, 23-mer
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5-hydroxyl and 3
-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in자세히 알아보기
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5-hydroxyl and 3
-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR
pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5-d(CGACTCACTATAGGGAGAGCGGC)-3
• pJET1.2 reverse sequencing primer, 24-mer: 5-d(AAGAACATCGATTTTCCATGGCAG)-3
Related products
pJET1.2 Reverse Sequencing Primer, 24-mer
사양
제품 유형Forward Sequencing Primer
배송 조건Dry Ice
농도10 μM
PrimerpJET
수량10 μM
벡터pJET1.2
용도(애플리케이션)Sequencing
형태Liquid
Unit Size10 µM
배송/결제/교환/반품 안내
배송 정보
기본 배송비 |
| 교환/반품 배송비 |
|
---|---|---|---|
착불 배송비 |
| ||
교환/반품 배송비 |
|
결제 및 환불 안내
결제 방법 |
|
---|---|
취소 |
|
반품 |
|
환급 |
|
교환 및 반품 접수
교환 및 반품 접수 기한 |
|
---|---|
교환 및 반품 접수가 가능한 경우 |
|
교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
교환 절차 |
|
---|---|
반품 절차 |
|