Thermo Fisher Scientific pJET1.2 Reverse Sequencing Primer, 24-mer

상품 한눈에 보기

단일가닥 올리고뉴클레오타이드로 구성된 Thermo Scientific pJET1.2 역방향 시퀀싱 프라이머. pJET1.2 벡터의 Eco32I 부위 양쪽을 인접하여 DNA 삽입 조각의 시퀀싱과 콜로니 PCR 스크리닝에 적합. 10 µM 수용액 형태로 제공.

카탈로그번호: SO511
브랜드: Thermo Fisher Scientific
카테고리: Nucleotides & Nucleosides
판매단위: pk

카탈로그

1개 옵션

회원가입 없이 바로 구매하세요

가입하지 않아도 비회원가로 구매하실 수 있습니다.

마지막 업데이트 2025. 07. 26. 오후 10:46

카탈로그 번호 · 상품 설명출고판매가담기

Thermo Fisher Scientific SO511 pJET1.2 Reverse Sequencing Primer, 24-mer 10 uM pk판매 단위 pk

재고 1개재고 1개

78,200원VAT 포함 86,020원

재고문의·견적요청 옵션은 실시간 상담으로 납기를 확인해 드립니다 · 연구비 카드 결제 가능

Thermo Fisher Scientific · Thermo Fisher Scientific pJET1.2 Reverse Sequencing Primer, 24-mer

Thermo Fisher Scientific pJET1.2 Reverse Sequencing Primer, 24-mer

Thermo Scientific™ sequencing primers are single-stranded oligonucleotides with 5’-hydroxyl and 3’-hydroxyl ends. The pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of the positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications

Sequencing of DNA fragments inserted into the Eco32I site within the eco47IR gene of pJET1.2 vector
Colony screening by PCR

pJET1.2 Primer Sequences

pJET1.2 Forward Sequencing Primer, 23-mer: 5’-d(CGACTCACTATAGGGAGAGCGGC)-3’
pJET1.2 Reverse Sequencing Primer, 24-mer: 5’-d(AAGAACATCGATTTTCCATGGCAG)-3’

pJET1.2 Forward Sequencing Primer, 23-mer

Specifications

항목	내용
제품 유형	Reverse Sequencing Primer
배송 조건	Dry Ice
농도	10 µM
Primer	pJET
수량	10 µM, 84 µL
벡터	pJET1.2
용도(애플리케이션)	Sequencing
형태	Liquid
Unit Size	10 µM