
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miR-132-5p를 표적하는 렌티바이러스 기반 microRNA 억제제. Tough Decoy(TuD) 설계로 강력한 miRNA 억제 가능. 다양한 세포 유형에 효율적으로 전달. 장기적인 억제 효과 및 퓨로마이신 선택 마커 포함.
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA Inhibitor, Mouse
Target: mmu-miR-132-5p
Design Type: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AACCGUGGCUUUCGAUUGUUAC |
| Sanger 성숙/소수 수납 번호 | MIMAT0016984 |
| microRNA 수납 번호 | MI0000158 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of the target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달 포맷으로 다양한 세포 유형에 효율적 전달
- 반복적 트랜스펙션 없이 장기적 억제 가능
- 퓨로마이신 저항성 마커 포함
🏷️Merck Sigma 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|