CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 miRNA 억제를 위한 렌티바이러스 기반 Tough Decoy 설계 제품입니다. 효율적 전달과 장기 억제 가능. TRC2-pLKO-puro 벡터 사용 및 퓨로마이신 선택 마커 포함. −70°C에서 건빙 상태로 배송.

카탈로그번호
MLTUD0038
브랜드
Merck Sigma
카테고리
Other Organics
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0038 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-130a-5p

Tough Decoy (TuD)


제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design. miRNA are known to regulate gene expression in various manners, including translational repression, mRNA cleavage, and deadenylation.

The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into appropriate cell lines with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors.
This lentiviral vector also carries a puromycin resistance gene for selection of cells.


주요 특징

  • Potent inhibition of the desired miRNA
  • Lentiviral delivery format allows efficient delivery into various cell types
  • Enables long-term inhibition without repeat transfection

제품 스펙

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 GCUCUUUUCACAUUGUGCUACU
Sanger 성숙/소수 수납 번호 MIMAT0016983
microRNA 수납 번호 MI0000156
배송 상태 Dry ice
저장 온도 −70°C

제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.