
Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral microRNA inhibitor for mouse mmu-miR-1934-3p. Utilizes Tough Decoy (TuD) design for potent, long-term inhibition. Delivered via lentiviral vector with puromycin resistance gene. Suitable for efficient transduction across various mammalian ce...
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
mmu-miR-1934-3p
Design
Tough Decoy (TuD)
제품 라인
MISSION®
품질 등급
200
물리적 형태
liquid
농도
≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
AGGAUGACGGUGGGGCUGGUGA
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
dry ice
저장 온도
−70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design. miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
Includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) to enhance transgene expression.
The vector carries a puromycin resistance gene for selection of transduced cells.
주요 특징
- Potent inhibition of target miRNA
- Lentiviral delivery enables efficient transduction into diverse cell types
- Long-term inhibition without the need for repeat transfection
🏷️Merck Sigma 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|