Merck MISSION Lenti microRNA Inhibitor, Mouse
개별 렌티바이러스 기반 microRNA 억제제로, 특정 miRNA의 강력하고 지속적인 억제를 제공합니다. Tough Decoy(TuD) 디자인을 적용하여 효율적 억제 가능. 다양한 세포 유형에 렌티바이러스 전달 형식으로 안정적 도입 가능. 퓨로마이신 내성 유전자를 포함하여 선택적 세포 배양에 적합.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-1940
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 (Quality Level) | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | AUGGAGGACUGAGAAGGUGGAGCAGUU |
| Sanger 성숙/소수 수납 번호 | MIMAT0009404 |
| microRNA 수납 번호 | MI0009929 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for effective inhibition of specific miRNAs.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, when co-transfected with compatible packaging plasmids, produces viral particles suitable for transducing mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) is included to enhance transgene expression.
The vector also carries a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 원하는 miRNA의 강력한 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 도입
- 반복적인 트랜스펙션 없이 장기적 억제 가능
- 퓨로마이신 내성 유전자를 통한 선택적 세포 배양 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.