Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target miRNA

• mmu-miR-3544-3p

Design Type

• Tough Decoy (TuD)

제품 라인

• MISSION®

품질 등급

• 200 (M-Clarity Program)

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• ACUCCUGCAUGACGCCGUUCCC

Sanger 성숙/소수 수납 번호

• MIMAT0022354

microRNA 수납 번호

• MI0019179

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T., et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to inhibit specific miRNA activity.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
Lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles for efficient transduction of mammalian cells.

The vector includes:

• Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
• Puromycin resistance gene for selection of transduced cells

주요 특징

• Potent inhibition of the desired miRNA
• Efficient lentiviral delivery across various cell types
• Long-term inhibition without repeat transfection