AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2Merck MISSION Lenti microRNA Inhibitor, Mouse
상품 한눈에 보기
마우스 mmu-miR-299b-5p 억제를 위한 렌티바이러스 기반 microRNA inhibitor. Tough Decoy(TuD) 설계로 강력한 miRNA 억제 가능. 다양한 세포형에 효율적으로 전달되며, 장기간 억제 유지. −70°C에서 건빙 상태로 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
카탈로그 번호 · 상품 설명출고판매가담기
Merck MLTUD1240 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원
Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-299b-5p
설계 방식
- Tough Decoy (TuD)
제품 라인
- MISSION®
품질 등급
- 200
형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- GGUUUACCGUCCCACAUACAU
등록 번호
| 구분 | 등록 번호 | 링크 |
|---|---|---|
| Sanger 성숙/소수 수납 번호 | MIMAT0022836 | mirbase.org |
| microRNA 수납 번호 | MI0019180 | mirbase.org |
배송 상태
- Dry Ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al.
This algorithm utilizes the Tough Decoy (TuD) design to enable potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
- Puromycin resistance gene for selection of successfully transduced cells
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달 형식으로 다양한 세포형에 적용 가능
- 반복적인 트랜스펙션 없이 장기간 억제 유지
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.