Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-299b-5p

설계 방식

• Tough Decoy (TuD)

제품 라인

• MISSION®

품질 등급

• 200

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• GGUUUACCGUCCCACAUACAU

등록 번호

배송 상태

• Dry Ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al.
This algorithm utilizes the Tough Decoy (TuD) design to enable potent inhibition of target miRNA.

miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.

The vector includes:

• WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
• Puromycin resistance gene for selection of successfully transduced cells

주요 특징

• 강력한 miRNA 억제 효과
• 렌티바이러스 전달 형식으로 다양한 세포형에 적용 가능
• 반복적인 트랜스펙션 없이 장기간 억제 유지