Thermo Fisher Scientific SP6 promoter Sequencing Primer, 24-mer
상품 옵션 정보 | ||||||||
---|---|---|---|---|---|---|---|---|
카탈로그 번호 | CAS 번호 | 설명 | 상태 | 단위 | 판매가 | 할인가 | 가격(VAT포함) | 수량 / 장바구니 / 찜 |
SO117 | - | Thermo Fisher Scientific SO117 SP6 promoter Sequencing Primer, 24-mer 10 uM pk | 재고문의 | pk | 256,000원 | - | 281,600원 |
다른 상품 둘러보기
Thermo Scientific™
SP6 promoter Sequencing Primer, 24-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5- and 3
-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer자세히 알아보기
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5- and 3
-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II
Promoter Sequence: 5-d (CATACGATTTAGGTGACACTATAG)-3
Related products
SP6 promoter Sequencing Primer, 18-mer
T7 promoter Sequencing Primer, 20-mer
T3 promoter Sequencing Primer, 17-mer
T3 promoter Sequencing Primer, 24-mer
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated
사양
프로모터SP6, T3, T7
제품 유형Sequencing Primer
배송 조건Dry Ice
농도10 μM
PrimerSP6
수량10 μM, 42 μL
벡터pTZ19R, pTZ57R, pBluescript II
용도(애플리케이션)Sequencing
형태Liquid
Unit Size10 µM
배송/결제/교환/반품 안내
배송 정보
기본 배송비 |
| 교환/반품 배송비 |
|
---|---|---|---|
착불 배송비 |
| ||
교환/반품 배송비 |
|
결제 및 환불 안내
결제 방법 |
|
---|---|
취소 |
|
반품 |
|
환급 |
|
교환 및 반품 접수
교환 및 반품 접수 기한 |
|
---|---|
교환 및 반품 접수가 가능한 경우 |
|
교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
교환 절차 |
|
---|---|
반품 절차 |
|