
Thermo Fisher Scientific SP6 promoter Sequencing Primer, 24-mer
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
Thermo Scientific™
SP6 promoter Sequencing Primer, 24-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5- and 3
-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer자세히 알아보기
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5- and 3
-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II
Promoter Sequence: 5-d (CATACGATTTAGGTGACACTATAG)-3
Related products
SP6 promoter Sequencing Primer, 18-mer
T7 promoter Sequencing Primer, 20-mer
T3 promoter Sequencing Primer, 17-mer
T3 promoter Sequencing Primer, 24-mer
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated
사양
프로모터SP6, T3, T7
제품 유형Sequencing Primer
배송 조건Dry Ice
농도10 μM
PrimerSP6
수량10 μM, 42 μL
벡터pTZ19R, pTZ57R, pBluescript II
용도(애플리케이션)Sequencing
형태Liquid
Unit Size10 µM
🏷️Thermo Fisher Scientific 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요

Thermo Fisher Scientific
Thermo Fisher Scientific M13/pUC sequencing primer (-20), 17-mer
513,200원

Thermo Fisher Scientific
Thermo Fisher Scientific Alpha SNAP Polyclonal Antibody, FITC
594,400원

Thermo Fisher Scientific
Thermo Fisher Scientific SP6 promoter Sequencing Primer, 24-mer
257,100원

Thermo Fisher Scientific
Thermo Fisher Scientific M13/pUC Sequencing Primer (-40), 17-mer
180,900원

Thermo Fisher Scientific
Thermo Fisher Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer
87,000원
배송/결제/교환/반품 안내
배송 정보
기본 배송비 |
| 교환/반품 배송비 |
|
---|---|---|---|
착불 배송비 |
| ||
교환/반품 배송비 |
|
결제 및 환불 안내
결제수단 |
|
---|---|
취소 |
|
반품 |
|
환급 |
|
교환 및 반품 접수
교환 및 반품 접수 기한 |
|
---|---|
교환 및 반품 접수가 가능한 경우 |
|
교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
교환 절차 |
|
---|---|
반품 절차 |
|