Thermo Fisher Scientific TheraPure GMP T7 RNA Polymerase (200 U/μL)

상품 옵션 정보

다양한 옵션의 상품 정보와 가격을 확인하세요

EP011SKB008C
Thermo Fisher Scientific EP011SKB008C TheraPure GMP T7 RNA Polymerase (200 U/uL) Each pk
CAS: -재고: -단위: pk
재고문의
7,298,100
(VAT포함)8,027,910
EP011SKB008C
재고문의
Thermo Fisher Scientific EP011SKB008C TheraPure GMP T7 RNA Polymerase (200 U/uL) Each pk
CAS: -재고: -단위: pk
7,298,100
(VAT포함)8,027,910

Thermo Scientific™

TheraPure™ GMP T7 RNA Polymerase (200 U/μL)

Thermo Scientific TheraPure GMP* T7 RNA Polymerase is manufactured to ICH Q7 GMP principles and supported by comprehensive documentation package.자세히 알아보기

Thermo Scientific TheraPure GMP* T7 RNA Polymerase is manufactured to ICH Q7 GMP principles and supported by comprehensive documentation package. It is designed for synthesis of mRNA in the development and manufacturing of mRNA therapeutics and vaccines. As an DNA-dependent RNA polymerase, it synthesizes RNA 5→3 from linear DNA containing the T7 promoter (TAATACGACTCACTATAGGGAGA).

Designed for process development and manufacturing

TheraPure GMP T7 RNA Polymerase helps accelerate mRNA vaccine and therapeutics production from preclinical development to commercialization by providing:

  • Quality—meet critical product quality needs to help accelerate therapeutic development and manufacturing
  • Minimal risk—help reduce risks in developing therapeutics by utilizing proven products
  • Technical partnership—partner with expert product and technical support
  • Secure and consistent supply—count on a secure and stable supply of product at a global scale

Comprehensive quality system

TheraPure GMP T7 RNA Polymerase is supported by a extensive quality system and documentation including:

  • Manufactured to relevant ICH Q7 GMP guidelines
  • Animal-origin free (AOF) manufacturing processes, materials, and facilities
  • Validated manufacturing processes and analytical test methods
  • Comprehensive impurity profiles
  • Verified compendial assays where applicable
  • Product stability data
  • Tested by analytical methods following ICH Q2 guidelines whenever possible
  • Drug master file (DMF)

Enzyme activity

One unit of enzyme incorporates 1 nmol of AMP into a polynucleotide fraction in 60 minutes at 37°C.

For additional TheraPure GMP products or customization, please visit www.thermofisher.com/therapure.

*TheraPure GMP refers to the quality level of the raw, ancillary, or starting materials to be used for further manufacturing. TheraPure GMP products are manufactured in facilities with ISO 9001–certified quality management systems that operate in accordance with relevant good manufacturing practice (GMP) principles, as outlined in ICH Q7 or equivalent guidance documents or standards.

사양

중합효소T7 RNA Polymerase

제품라인TheraPure™ GMP

프로모터T7

용도(애플리케이션)IVT Transcription, RNA Synthesis, mRNA Synthesis

수량200 kU

농도200 U/μL

보관 버퍼25 mM HEPES-NaOH, pH 7.6, 0.1 mM EDTA-Na2, 150 mM NaCl, 10 mM DTT, 0.09% Triton X-100, 50% glycerol

질량99 kDa

소스Bacteriophage T7

pH 범위7.2 to 8

Unit SizeEach


배송/결제/교환/반품 안내

배송 정보

기본 배송비
  • - 배송비 3,850원 (부가세 포함)
  • - 10만원 이상 구매시 배송비 무료
  • - 도서산간 및 제주를 포함한 일부 지역 추가비용 발생
  • - 장비의 경우 추가 배송비 및 설치비가 청구 될 수 있습니다
교환/반품 배송비
  • - 상품 별로 상이
착불 배송비
  • - 착불 적용 상품에 개별 부과 (상품 별로 상이)
교환/반품 배송비
  • - 상품 별로 상이

결제 및 환불 안내

결제수단
  • - 신용카드
  • - 가상계좌
  • - 연구비카드
  • - 세금계산서 (기업은행 033-502993-01-019)
  • - 세금계산서 (신한은행 100-032-703829)
  • - 상품 결제 후 최대 60일 이내 제공 완료
취소
  • - 취소 접수 후 3 ~ 5일 이내 환불 처리
반품
  • - 반품 접수 후 3 ~ 5일 이내 환불 처리
환급
  • - 회사는 회원이 구매신청한 상품 등이 품절 등의 사유로 인도 또는 제공할 수 없을 때에는 지체 없이 그 사유를 회원에게 통지하고,
      사전에 상품 등의 대금을 받은 경우에는 대금을 받은 날로부터 3영업일 이내에 환급하거나 환급에 필요한 조치를 취합니다.

교환 및 반품 접수

교환 및 반품 접수 기한
  • - 상품 수령일로부터 7일 이내
교환 및 반품 접수가 가능한 경우
  • - 제품의 하자는 없지만, 다른 상품으로 교환하거나 반품 원하는 경우
     (배송비 고객 부담)
  • - 상품자체 불량 및 하자에 의한 경우
  • - 상품 오배송에 의한 경우
교환 및 반품 접수가 불가능한 경우
  • - 상품 수령 후 7일을 초과한 경우
  • - 개별 포장 상품의 포장을 훼손한 경우
  • - 고객의 고의적인 귀책으로 상품가치가 훼손된 경우
  • - 주문제작을 통해서 제품을 생산하는 경우
  • - 주문 당시 재고가 없어서 해외를 통해 제품을 수입해서 구매하는 경우

교환 및 반품 신청

교환 절차
  • - 상품 불량/오배송/상품파손
  • - 전화(02-585-1342) 또는 info@cacheby.com에 상품교환 접수
반품 절차
  • - 반품할 품목을 확인 후 info@cacheby.com로 반품 신청 (수령 후 7일 이내 가능하며 이후 불가)
  • - 전달드린 주문번호와 함께 반품 상품을 포장
     (포장을 꼼꼼하게 해주셔야 반품 상품 손상에 따른 불이익이 없습니다.)
  • - 택배회사 방문 시 반품 상품 전달
     (택배사의 반송장은 상품 교환이 완료될 때까지 보관해주시기 바랍니다.)
  • - 회수된 제품 확인 후 하자없을시 배송비를 제외하고 환불 처리 진행
     (환불 처리 후 입금까지 최대 2주까지 소요될 수 있습니다.)

문의 0