Takara Direct viral detection via qPCR

상품 옵션 정보
카탈로그 번호CAS 번호설명상태단위판매가할인가가격(VAT포함)수량 / 장바구니 / 찜
RR650B-Takara RR650B PrimeDirect™ Probe RT-qPCR Mix, 1,000 Rxns pk재고문의pk2,320,000-2,552,000
RR650A-Takara RR650A PrimeDirect™ Probe RT-qPCR Mix, 200 Rxns pk재고문의pk516,000-567,600

Overview

Protocol guidelines for direct SARS-CoV-2 detection using RT-qPCR

PrimeDirect Probe RT-qPCR Mix has been successfully tested by Takara Bio`s R&D team on influenza A virus H1N1 spiked into biological samples, but we have not yet tested it with SARS-CoV-2-positive patient samples. However, protocol guidelines for SARS-CoV-2 detection have been developed by other groups.

Lübke et al. described their simple SARS-CoV-2 detection protocol for respiratory samples using PrimeDirect Probe RT-qPCR Mix in a Journal of Clinical Virology paper titled, Extraction-free SARS-CoV-2 detection by rapid RT-qPCR universal for all primary respiratory materials. Here is a summary of their protocol, which may require optimization by the user.


RNA-extraction-free SARS-CoV-2 detection protocol

This protocol, developed by Lübke et al., can be used as a guideline for SARS-CoV-2 detection. It has not been validated by our R&D team for SARS-CoV-2 detection from patient samples.

Sample collection

In order to maintain reaction sensitivity, do not freeze or store samples at 4°C for more than seven days. This protocol is applicable for all primary respiratory samples.

  1. Preincubate viscous samples with Remel Sputasol (Thermo Fisher Scientific).
  2. Heat inactivate 50 µl of sample at 99°C for 5 min.
  3. Centrifuge heated samples at 4,000 rpm for 5 min.
  4. Add 5 µl of supernatant to the following reaction mix.

Reaction mix

The reaction mix (without respiratory sample) can be prepared in bulk quantity, and aliquots of 20 µl can be frozen for up to one week before use.

Reagent Volume
PrimeDirect Probe RT-qPCR Mix (2X) 12.5 µl
Forward Primer Calculate based on table below
Reverse Primer Calculate based on table below
qPCR probe Calculate based on table below
Viral PBS sample 5 µl
RNase Free H2O Fill to 25 µl
Total 25 µl

Primer and probes for SARS-CoV-2 detection and an internal control by direct RT-qPCR

Name Target Sequence Final conc. in rxn
CoV-E-F E gene CTTTTTCTTGCTTTCGTGGTATTCT 400 nM
CoV-E-R E gene TACAAGACTCACGTTAACAATATTGCA 400 nM
CoV-E-Pr E gene FAM-CTAGCCATCCTTACTGCGCTTCGATTGTG-BHQ 200 nM
HBV‑Taq1 HBV‑SynQ* CAACCTCCAATCACTCACCAAC 200 nM
HBV‑Taq2 HBV‑SynQ* ATATGATAAAACGCGCAGACAC 200 nM
HBV‑IC HBV‑SynQ* Cy5-CTGCCGAGCTCTGACTA-BHQ 200 nM

*HBV-SynQ (internal control): a synthetic plasmid coding for an inactivated S antigen of hepatitis B.

Thermal cycler program

95°C 30 sec Enzyme activation step
60°C 5 min Reverse transcription
Number of cycles: 45
95°C 5 sec Denaturation
60°C 30 sec Annealing/extension

With this protocol, the authors found a very high SARS-CoV-2 detection rate of 95.8% for Ct values <35 by direct RT-qPCR and an overall detection rate of 81.3%. Due to the flexibility and speed of this protocol, any respiratory sample can be utilized for SARS-CoV-2 detection in under one hour.

More Information

Please see the product`s Certificate of Analysis for information about storage conditions, product components, and technical specifications. Please see the Kit Components List to determine kit components. Certificates of Analysis and Kit Components Lists are located under the Documents tab.


배송/결제/교환/반품 안내

배송 정보

기본 배송비
  • - 배송비 3,850원 (부가세 포함)
  • - 10만원 이상 구매시 배송비 무료
  • - 도서산간 및 제주를 포함한 일부 지역 추가비용 발생
  • - 장비의 경우 추가 배송비 및 설치비가 청구 될 수 있습니다
교환/반품 배송비
  • - 상품 별로 상이
착불 배송비
  • - 착불 적용 상품에 개별 부과 (상품 별로 상이)
교환/반품 배송비
  • - 상품 별로 상이

결제 및 환불 안내

결제 방법
  • - 신용카드
  • - 가상계좌
  • - 연구비카드 결제 (결제링크 문자+이메일 전송)
  • - 세금계산서 (기업은행 033-502993-01-019)
  • - 세금계산서 (신한은행 100-032-703829)
  • - 상품 결제 후 최대 60일 이내 제공 완료
취소
  • - 취소 접수 후 3 ~ 5일 이내 환불 처리
반품
  • - 반품 접수 후 3 ~ 5일 이내 환불 처리
환급
  • - 회사는 회원이 구매신청한 상품 등이 품절 등의 사유로 인도 또는 제공할 수 없을 때에는 지체 없이 그 사유를 회원에게 통지하고,
      사전에 상품 등의 대금을 받은 경우에는 대금을 받은 날로부터 3영업일 이내에 환급하거나 환급에 필요한 조치를 취합니다.

교환 및 반품 접수

교환 및 반품 접수 기한
  • - 상품 수령일로부터 7일 이내
교환 및 반품 접수가 가능한 경우
  • - 제품의 하자는 없지만, 다른 상품으로 교환하거나 반품 원하는 경우
     (배송비 고객 부담)
  • - 상품자체 불량 및 하자에 의한 경우
  • - 상품 오배송에 의한 경우
교환 및 반품 접수가 불가능한 경우
  • - 상품 수령 후 7일을 초과한 경우
  • - 개별 포장 상품의 포장을 훼손한 경우
  • - 고객의 고의적인 귀책으로 상품가치가 훼손된 경우
  • - 주문제작을 통해서 제품을 생산하는 경우
  • - 주문 당시 재고가 없어서 해외를 통해 제품을 수입해서 구매하는 경우

교환 및 반품 신청

교환 절차
  • - 상품 불량/오배송/상품파손
  • - 전화(02-585-1342) 또는 info@cacheby.com에 상품교환 접수
반품 절차
  • - 반품할 품목을 확인 후 info@cacheby.com로 반품 신청 (수령 후 7일 이내 가능하며 이후 불가)
  • - 전달드린 주문번호와 함께 반품 상품을 포장
     (포장을 꼼꼼하게 해주셔야 반품 상품 손상에 따른 불이익이 없습니다.)
  • - 택배회사 방문 시 반품 상품 전달
     (택배사의 반송장은 상품 교환이 완료될 때까지 보관해주시기 바랍니다.)
  • - 회수된 제품 확인 후 하자없을시 배송비를 제외하고 환불 처리 진행
     (환불 처리 후 입금까지 최대 2주까지 소요될 수 있습니다.)

문의 0