Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

• mmu-miR-3076-3p

Design Type

• Tough Decoy (TuD)

품질 등급

• 200 (M-Clarity Program)

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• CGCACUCUGGUCUUCCCUUGCAG

Sanger 성숙/소수 수납 번호

• MIMAT0014861

microRNA 수납 번호

• MI0014039

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of specific miRNAs.

miRNAs regulate gene expression through various mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, upon co-transfection with compatible packaging plasmids, produces viral particles suitable for transduction of mammalian cells.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) is included to enhance transgene expression.
The vector also carries a puromycin resistance gene for selection of successfully transduced cells.

주요 특징

• 강력한 miRNA 억제 가능
• 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 전달
• 반복적인 트랜스펙션 없이 장기 억제 가능
• 선택 마커(puromycin resistance gene) 포함