
Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral microRNA inhibitor for mouse miR-3062-5p. Tough Decoy (TuD) design enables potent and stable miRNA inhibition. Efficient lentiviral delivery into diverse cell types. Includes puromycin resistance for selection and WPRE for enhanced expression.
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
- mmu-miR-3062-5p
Design
- Tough Decoy (TuD) technology for potent inhibition
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | GGAGAAUGUAGUGUUACCGUGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0014830 |
| microRNA 수납 번호 | MI0014024 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the Tough Decoy (TuD) design for efficient inhibition of target miRNAs.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2) for enhanced transgene expression
- Puromycin resistance gene for selection of successfully transduced cells
주요 특징
- Potent inhibition of target miRNA
- Efficient lentiviral delivery into various cell types
- Long-term inhibition without repeat transfection
🏷️Merck Sigma 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|