Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral microRNA inhibitor for mouse miR-3062-5p. Tough Decoy (TuD) design enables potent and stable miRNA inhibition. Efficient lentiviral delivery into diverse cell types. Includes puromycin resistance for selection and WPRE for enhanced expression.
- 카탈로그번호
- MLTUD0984
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
- mmu-miR-3062-5p
Design
- Tough Decoy (TuD) technology for potent inhibition
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | GGAGAAUGUAGUGUUACCGUGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0014830 |
| microRNA 수납 번호 | MI0014024 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the Tough Decoy (TuD) design for efficient inhibition of target miRNAs.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2) for enhanced transgene expression
- Puromycin resistance gene for selection of successfully transduced cells
주요 특징
- Potent inhibition of target miRNA
- Efficient lentiviral delivery into various cell types
- Long-term inhibition without repeat transfection
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.