CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

Lentiviral microRNA inhibitor for mouse miR-3062-5p. Tough Decoy (TuD) design enables potent and stable miRNA inhibition. Efficient lentiviral delivery into diverse cell types. Includes puromycin resistance for selection and WPRE for enhanced expression.

카탈로그번호
MLTUD0984
브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0984 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

  • mmu-miR-3062-5p

Design

  • Tough Decoy (TuD) technology for potent inhibition

제품 정보

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 GGAGAAUGUAGUGUUACCGUGA
Sanger 성숙/소수 수납 번호 MIMAT0014830
microRNA 수납 번호 MI0014024
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the Tough Decoy (TuD) design for efficient inhibition of target miRNAs.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.

The vector includes:

  • WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2) for enhanced transgene expression
  • Puromycin resistance gene for selection of successfully transduced cells

주요 특징

  • Potent inhibition of target miRNA
  • Efficient lentiviral delivery into various cell types
  • Long-term inhibition without repeat transfection

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.