
Merck MISSION Lenti microRNA Inhibitor, Mouse
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-2137
Tough Decoy, TuD
Quality Level
제품 라인
MISSION®
form
liquid
농도
≥1x106 VP/ml (via p24 assay)
성숙 서열
GCCGGCGGGAGCCCCAGGGAG
상거(Sanger) 성숙/소수 수납 번호
상거 microRNA 수납 번호
배송 상태
dry ice
저장 온도
−70°C
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.
Allows for potent inhibition of the desired miRNA
Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
Enables long-term inhibition without repeat transfection
🏷️Merck Sigma 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|
