Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-1197-5p를 표적하는 렌티바이러스 기반 microRNA 억제제입니다. Tough Decoy(TuD) 설계를 적용해 강력하고 지속적인 miRNA 억제를 제공합니다. 다양한 세포 유형에 효율적으로 전달되며, 퓨로마이신 선택 마커를 포함합니다. −70°C에서 건빙 상태로 배송됩니다.
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA Inhibitor, Mouse
Target miRNA
mmu-miR-1197-5p
Design Type
Tough Decoy (TuD)
품질 등급
200
제품 라인
MISSION®
제형
Liquid
농도
≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
CGGUUGACCAUGGUGUGUACG
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
Dry ice
저장 온도
−70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo). This algorithm utilizes the Tough Decoy (TuD) design to achieve potent and specific inhibition of target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- Potent inhibition of the desired miRNA
- Efficient lentiviral delivery into diverse cell types
- Enables long-term inhibition without repeat transfection
제품 스펙 요약
| 항목 | 내용 |
|---|---|
| Target miRNA | mmu-miR-1197-5p |
| Design Type | Tough Decoy (TuD) |
| Quality Level | 200 |
| Product Line | MISSION® |
| Form | Liquid |
| Concentration | ≥1×10⁶ VP/ml (via p24 assay) |
| Mature Sequence | CGGUUGACCAUGGUGUGUACG |
| Sanger Accession | MIMAT0017331 |
| miRNA Accession | MI0006305 |
| Shipping | Dry ice |
| Storage Temperature | −70°C |
🏷️Merck Sigma 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요
Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원
Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원
Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원
Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원
Merck Sigma
Merck MISSION Lenti microRNA Inhibitor, Mouse
981,060원
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|