
Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral 기반의 microRNA 억제제로, miRNA의 발현을 효율적으로 억제합니다. Tough Decoy(TuD) 설계로 강력한 억제 효과를 제공합니다. 다양한 세포 유형에 안정적으로 전달 가능하며, 퓨로마이신 내성 유전자를 포함합니다. −70°C에서 보관합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-302b-5p
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | ACUUUAACAUGGGAAUGCUUUCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0003373 |
| microRNA 수납 번호 | MI0003716 |
| 배송 상태 (Shipping Conditions) | Dry ice |
| 저장 온도 (Storage Temperature) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design for potent and specific inhibition of target miRNAs.
MicroRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효능 제공
- Lentiviral 전달 형식으로 다양한 세포에 효율적 전달
- 반복 형질감염 없이 장기적 억제 가능
- 퓨로마이신 내성 유전자를 포함하여 세포 선택 용이
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



