Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-503-5p

형식

• Tough Decoy (TuD)

제품 라인

• MISSION®

품질 등급

• 200

제형

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UAGCAGCGGGAACAGUACUGCAG

Sanger 성숙/소수 수납 번호

• MIMAT0003188

microRNA 수납 번호

• MI0003538

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba, University of Tokyo, based on the work of Haraguchi et al. This algorithm utilizes the Tough Decoy (TuD) design for effective miRNA inhibition.

miRNAs regulate gene expression through various mechanisms including translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression, and the vector includes a puromycin resistance gene for selection of successfully transduced cells.

주요 특징

• 강력한 miRNA 억제 가능
• Lentiviral 전달 형식으로 다양한 세포 유형에 효율적 전달
• 반복적인 트랜스펙션 없이 장기 억제 가능
• WPRE 포함으로 발현 강화
• Puromycin 선택 마커 내장