
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA 억제제는 Tough Decoy(TuD) 설계를 기반으로 한 렌티바이러스 전달 포맷으로 효율적인 miRNA 억제를 제공합니다. TRC2-pLKO-puro 벡터에 클로닝되어 다양한 세포형에 적용 가능하며, 장기적 억제 효과와 퓨로마이신 선택 기능을 제공합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
타깃 microRNA
- mmu-miR-302c-5p
디자인
- Tough Decoy (TuD) 기반 설계
품질 등급
제품 라인
- MISSION®
물리적 형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- GCUUUAACAUGGGGUUACCUGC
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) is included for enhanced transgene expression.
The vector also carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 포맷으로 다양한 세포형에 효율적 적용 가능
- 반복적인 트랜스펙션 없이 장기적 억제 가능
- 퓨로마이신 저항성 유전자를 통한 선택적 세포 선별 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



