Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral 기반 microRNA 억제제로, 목표 miRNA의 강력한 억제를 제공합니다. 다양한 세포 유형에 효율적으로 전달되며, 반복 형질감염 없이 장기 억제가 가능합니다. Tough Decoy(TuD) 설계 기반으로 높은 특이성과 안정성을 제공합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-20b-3p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to effectively inhibit target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
When co-transfected with compatible packaging plasmids, viral particles are produced for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.
주요 특징
- 목표 miRNA의 강력하고 특이적인 억제
- Lentiviral 전달로 다양한 세포 유형에 효율적 적용 가능
- 반복적인 형질감염 없이 장기 억제 가능
- Tough Decoy(TuD) 기반 설계로 높은 안정성 확보
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | ACUGCAGUGUGAGCACUUCUAG |
| Sanger 성숙/소수 수납 번호 | MIMAT0004788 |
| microRNA 수납 번호 | MI0003536 |
| 배송 상태 (Shipping Condition) | Dry ice |
| 저장 온도 (Storage Temperature) | −70°C |
참고 문헌
- Haraguchi, T. et al., University of Tokyo – Development of the Tough Decoy (TuD) design for miRNA inhibition.
제품 이미지
(해당 제품의 이미지가 있을 경우 이 섹션에 배치됩니다.)
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.