Merck MISSION Lenti microRNA Inhibitor, Mouse
miRNA 기능 억제를 위한 렌티바이러스 기반 억제제. Tough Decoy(TuD) 디자인 적용으로 강력한 억제 효율 제공. 다양한 세포 유형에 안정적으로 전달 가능. 퓨로마이신 내성 유전자를 포함하여 선별 용이. 장기적 miRNA 억제 유지 가능.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target: mmu-miR-503-3p
Design: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 (Quality Level) | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | GAGUAUUGUUUCCACUGCCUGG |
| Sanger 성숙/소수 수납 번호 | MIMAT0004790 |
| microRNA 수납 번호 | MI0003538 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, when co-transfected with compatible packaging plasmids, produces viral particles for efficient mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력한 miRNA 억제 효율 (Tough Decoy 디자인 기반)
- 다양한 세포 유형에 렌티바이러스 전달 가능
- 반복 형질감염 없이 장기적 억제 유지
- 퓨로마이신 내성 유전자로 선택 용이
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.