CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-425-3p 억제를 위한 렌티바이러스 기반 microRNA inhibitor TuD(Tough Decoy) 디자인으로 강력한 miRNA 억제 효과 제공 TRC2-pLKO-puro 벡터 기반으로 다양한 세포에 효율적 전달 Puromycin 저항성 유전자 포함으로 안정적 세포 선택 가능 −70°C에서 건빙 상태로 배송 및 보관

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0451 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-425-3p

Tough Decoy (TuD) Design

제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design for potent inhibition of specific miRNA targets.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
Lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, co-transfected with compatible packaging plasmids to produce viral particles for mammalian cell transduction.

The vector includes:

  • WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
  • Puromycin resistance gene for stable selection of transduced cells

주요 특징

  • 강력한 miRNA 억제 효과
  • 다양한 세포 유형에 효율적 렌티바이러스 전달
  • 반복적인 트랜스펙션 없이 장기적 억제 가능

제품 사양

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 AUCGGGAAUGUCGUGUCCGCC
Sanger 성숙/소수 수납 번호 MIMAT0001342
microRNA 수납 번호 MI0001447
배송 상태 Dry ice
저장 온도 −70°C

제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.