
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-434-3p 표적 억제를 위한 렌티바이러스 기반 microRNA inhibitor. Tough Decoy(TuD) 디자인으로 강력하고 지속적인 억제 가능. 다양한 세포 유형에 효율적으로 전달되며, 퓨로마이신 선택 마커 포함.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target miRNA
mmu-miR-434-3p
Design
Tough Decoy (TuD)
품질 등급
200
제품 라인
MISSION®
물리적 형태
Liquid
농도
≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
UUUGAACCAUCACUCGACUCCU
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
Dry ice
저장 온도
−70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of specific miRNA targets.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달 포맷으로 다양한 세포 유형에 효율적 도입 가능
- 반복적인 트랜스펙션 없이 장기적 억제 유지
제품 스펙 요약
| 항목 | 내용 |
|---|---|
| Target miRNA | mmu-miR-434-3p |
| Design | Tough Decoy (TuD) |
| Quality Level | 200 |
| Product Line | MISSION® |
| Form | Liquid |
| Concentration | ≥1×10⁶ VP/ml (via p24 assay) |
| Mature Sequence | UUUGAACCAUCACUCGACUCCU |
| Sanger Accession | MIMAT0001422 |
| microRNA Accession | MI0001526 |
| Shipping Condition | Dry ice |
| Storage Temperature | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



