CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스용 MISSION Lenti microRNA 억제제는 Tough Decoy(TuD) 설계를 기반으로 한 렌티바이러스 전달 시스템입니다. 다양한 세포 유형에 효율적으로 전달 가능하며, 장기적인 miRNA 억제를 제공합니다. puromycin 선택 마커 포함.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0447 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-412-3p

Tough Decoy (TuD) 설계 기반


제품 정보

항목 내용
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 UUCACCUGGUCCACUAGCCG
Sanger 성숙/소수 수납 번호 MIMAT0001094
microRNA 수납 번호 MI0001164
품질 등급 200
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design to effectively inhibit specific miRNA activity.

miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which enables co-transfection with compatible packaging plasmids to produce viral particles for transduction into mammalian cells.

The vector includes:

  • Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression
  • Puromycin resistance gene for cell selection

주요 특징

  • 강력한 miRNA 억제 효과
  • 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 적용
  • 반복적인 트랜스펙션 없이 장기적 억제 가능

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.