
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA 억제제는 Tough Decoy(TuD) 설계를 기반으로 한 렌티바이러스 전달 시스템입니다. 다양한 세포 유형에 효율적으로 전달 가능하며, 장기적인 miRNA 억제를 제공합니다. puromycin 선택 마커 포함.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-412-3p
Tough Decoy (TuD) 설계 기반
제품 정보
| 항목 | 내용 |
|---|---|
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UUCACCUGGUCCACUAGCCG |
| Sanger 성숙/소수 수납 번호 | MIMAT0001094 |
| microRNA 수납 번호 | MI0001164 |
| 품질 등급 | 200 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design to effectively inhibit specific miRNA activity.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which enables co-transfection with compatible packaging plasmids to produce viral particles for transduction into mammalian cells.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression
- Puromycin resistance gene for cell selection
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 적용
- 반복적인 트랜스펙션 없이 장기적 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



