Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

타깃 miRNA

• mmu-miR-433-5p

형식

• Tough Decoy (TuD)

품질 등급

• 200

제품 라인

• MISSION®

형태

• liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UACGGUGAGCCUGUCAUUAUUC

Sanger 성숙/소수 수납 번호

• MIMAT0001419

microRNA 수납 번호

• MI0001525

배송 상태

• dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the Tough Decoy (TuD) design.

miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles for transduction into mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.

주요 특징

• 원하는 miRNA의 강력한 억제 가능
• 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달
• 반복적 트랜스펙션 없이 장기적 억제 가능