
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miRNA 억제를 위한 렌티바이러스 기반 MISSION Lenti microRNA Inhibitor. Tough Decoy(TuD) 설계로 강력한 억제 효과 제공. 다양한 세포 유형에 효율적으로 전달 가능. 퓨로마이신 내성 유전자로 안정적 세포 선택 가능. 장기적 억제 유지에 적합.
- 카탈로그번호
- MLTUD0237
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-27a-3p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효과 (Tough Decoy 설계 기반)
- 다양한 세포 유형에 렌티바이러스 방식으로 효율적 전달
- 반복 형질감염 없이 장기적 억제 유지 가능
- 퓨로마이신 내성 유전자를 통한 안정적 세포 선택 가능
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UUCACAGUGGCUAAGUUCCGC |
| Sanger 성숙/소수 수납 번호 | MIMAT0000537 |
| microRNA 수납 번호 | MI0000578 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
참고 문헌
Haraguchi, T. et al. (University of Tokyo) 연구 기반 알고리즘 적용.
적용 분야
- miRNA 기능 연구
- 유전자 발현 조절 메커니즘 분석
- 장기적 miRNA 억제 모델 구축
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



