
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-29c-5p를 표적하는 렌티바이러스 기반 microRNA 억제제 Tough Decoy(TuD) 디자인으로 강력한 miRNA 억제 효과 제공 puromycin 저항성 유전자를 포함하여 세포 선택 가능 다양한 세포 유형에서 효율적인 전달 및 장기적 억제 가능 −70°C에서 건빙 상태로 배송
- 카탈로그번호
- MLTUD0235
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-29c-5p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입 가능
- 반복적인 트랜스펙션 없이 장기적 억제 가능
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGACCGAUUUCUCCUGGUGUUC |
| Sanger 성숙/소수 수납 번호 | MIMAT0004632 |
| microRNA 수납 번호 | MI0000577 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



