CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-29c-5p를 표적하는 렌티바이러스 기반 microRNA 억제제 Tough Decoy(TuD) 디자인으로 강력한 miRNA 억제 효과 제공 puromycin 저항성 유전자를 포함하여 세포 선택 가능 다양한 세포 유형에서 효율적인 전달 및 장기적 억제 가능 −70°C에서 건빙 상태로 배송

브랜드
Merck Sigma
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0235 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-29c-5p

Tough Decoy (TuD) Design


제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.

miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The vector includes:

  • Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression
  • Puromycin resistance gene for selection of transduced cells

주요 특징

  • 강력한 miRNA 억제 효과 제공
  • 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입 가능
  • 반복적인 트랜스펙션 없이 장기적 억제 가능

제품 사양

항목 내용
Quality Level 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 UGACCGAUUUCUCCUGGUGUUC
Sanger 성숙/소수 수납 번호 MIMAT0004632
microRNA 수납 번호 MI0000577
배송 상태 Dry ice
저장 온도 −70°C

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.