
Merck MISSION Lenti microRNA Inhibitor, Mouse
Tough Decoy(TuD) 디자인을 적용한 렌티바이러스 기반 microRNA 억제제. 다양한 세포에 효율적으로 전달 가능하며, 장기적인 miRNA 억제 효과 제공. 퓨로마이신 내성 유전자를 포함하여 세포 선별 용이. −70°C에서 보관, 드라이아이스로 배송.
- 카탈로그번호
- MLTUD0234
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-29c-3p
Tough Decoy (TuD)
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| Form | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UAGCACCAUUUGAAAUCGGUUA |
| Sanger 성숙/소수 수납 번호 | MIMAT0000536 |
| microRNA 수납 번호 | MI0000577 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
microRNA (miRNA) are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) is included to enhance transgene expression.
The lentiviral vector carries a puromycin resistance gene for selection of transduced cells.
주요 특징
- Potent inhibition of the desired miRNA
- Efficient delivery into a wide variety of cell types via lentiviral system
- Enables long-term inhibition without repeat transfection
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



