CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스용 MISSION Lenti microRNA Inhibitor는 특정 miRNA를 강력하게 억제하는 Tough Decoy(TuD) 설계를 기반으로 합니다. 렌티바이러스 전달 형식으로 다양한 세포에 효율적으로 도입 가능하며, 장기적인 억제 효과를 제공합니다. 퓨로마이신 내성 유전자를 포함하여 선택이 용이합니다.

카탈로그번호
MLTUD0236
브랜드
Merck Sigma
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0236 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

  • mmu-miR-27a-5p

설계 방식

  • Tough Decoy (TuD) 기반 설계
  • Haraguchi, T. 및 Dr. Hideo Iba (도쿄대학)과의 공동 연구를 바탕으로 한 독자 알고리즘 적용

품질 등급

  • 200 (M-Clarity Program)

제품 라인

  • MISSION®

형태 및 농도

항목 내용
Form Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)

서열 정보

항목 내용
성숙 서열 AGGGCUUAGCUGCUUGUGAGCA
Sanger 성숙/소수 수납 번호 MIMAT0004633
microRNA 수납 번호 MI0000578

배송 및 보관

항목 내용
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T, et al., in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the Tough Decoy (TuD) design.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.

The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included for enhanced transgene expression.
This vector also carries a puromycin resistance gene for efficient selection.

주요 특징

  • 원하는 miRNA의 강력한 억제 가능
  • 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입
  • 반복적인 트랜스펙션 없이 장기적 억제 가능
  • 퓨로마이신 내성 유전자 포함으로 선택 용이

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.