Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 특정 miRNA를 강력하게 억제하는 Tough Decoy(TuD) 설계를 기반으로 합니다. 렌티바이러스 전달 형식으로 다양한 세포에 효율적으로 도입 가능하며, 장기적인 억제 효과를 제공합니다. 퓨로마이신 내성 유전자를 포함하여 선택이 용이합니다.
- 카탈로그번호
- MLTUD0236
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 miRNA
- mmu-miR-27a-5p
설계 방식
- Tough Decoy (TuD) 기반 설계
- Haraguchi, T. 및 Dr. Hideo Iba (도쿄대학)과의 공동 연구를 바탕으로 한 독자 알고리즘 적용
품질 등급
- 200 (M-Clarity Program)
제품 라인
- MISSION®
형태 및 농도
| 항목 | 내용 |
|---|---|
| Form | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
서열 정보
| 항목 | 내용 |
|---|---|
| 성숙 서열 | AGGGCUUAGCUGCUUGUGAGCA |
| Sanger 성숙/소수 수납 번호 | MIMAT0004633 |
| microRNA 수납 번호 | MI0000578 |
배송 및 보관
| 항목 | 내용 |
|---|---|
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T, et al., in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the Tough Decoy (TuD) design.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included for enhanced transgene expression.
This vector also carries a puromycin resistance gene for efficient selection.
주요 특징
- 원하는 miRNA의 강력한 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입
- 반복적인 트랜스펙션 없이 장기적 억제 가능
- 퓨로마이신 내성 유전자 포함으로 선택 용이
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.