Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target miRNA

mmu-miR-374b-5p

Design Type

Tough Decoy (TuD)

제품 라인

MISSION®

품질 등급

200

형태

Liquid

농도

≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

AUAUAAUACAACCUGCUAAGUG

miRBase 등록번호

MIMAT0003727

저장 온도

−70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.

MicroRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of successfully transduced cells.

주요 특징

• 강력한 목표 miRNA 억제 가능
• 다양한 세포 유형에 효율적인 렌티바이러스 전달
• 반복적인 트랜스펙션 없이 장기간 miRNA 억제 유지
• 퓨로마이신 내성 유전자 포함으로 안정적 세포 선택 가능