
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-374b-5p를 표적하는 Tough Decoy 기반 렌티바이러스형 microRNA 억제제. 효율적인 렌티바이러스 전달로 다양한 세포에 적용 가능. 장기간 miRNA 억제 효과를 제공하며, 퓨로마이신 내성 유전자를 포함해 안정적인 세포 선택 가능.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target miRNA
mmu-miR-374b-5p
Design Type
Tough Decoy (TuD)
제품 라인
MISSION®
품질 등급
200
형태
Liquid
농도
≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
AUAUAAUACAACCUGCUAAGUG
miRBase 등록번호
저장 온도
−70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
MicroRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력한 목표 miRNA 억제 가능
- 다양한 세포 유형에 효율적인 렌티바이러스 전달
- 반복적인 트랜스펙션 없이 장기간 miRNA 억제 유지
- 퓨로마이신 내성 유전자 포함으로 안정적 세포 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



