
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-374b-3p를 표적하는 렌티바이러스 기반 microRNA 억제제. Tough Decoy(TuD) 디자인으로 강력한 억제 효과 제공. 다양한 세포 유형에 효율적으로 전달 가능하며, 장기간 지속 억제 가능. Puromycin 저항성 유전자를 포함해 안정적 선택 가능.
- 카탈로그번호
- MLTUD0337
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target miRNA
mmu-miR-374b-3p
Design
Tough Decoy (TuD)
품질 등급
200
제품 라인
MISSION®
형태
Liquid
농도
≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
GGUUGUAUUAUCAUUGUCCGAG
Sanger 성숙/소수 수납 번호
저장 온도
−70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to effectively inhibit target miRNA activity.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for stable cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달
- 반복적인 트랜스펙션 없이 장기간 억제 가능
- Puromycin 저항성 유전자를 통한 안정적 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



