Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

• mmu-miR-3102-3p

디자인 형식

• Tough Decoy (TuD)

품질 등급

• 200

제품 라인

• MISSION®

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

GAGCACCCCAUUGGCUACCCACA

Sanger 성숙/소수 수납 번호

• MIMAT0014936

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles that transduce mammalian cells efficiently.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression delivered by lentiviral vectors.
The vector also includes a puromycin resistance gene for cell selection.

주요 특징

• Potent inhibition of target miRNA
• Efficient lentiviral delivery across various cell types
• Long-term inhibition without repeat transfection