CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 miRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 형식의 억제제입니다. 효율적인 세포 내 전달 및 장기적 miRNA 억제 가능. TRC2-pLKO-puro 벡터 기반으로 구성되어 있으며, 퓨로마이신 내성 유전자 포함. WPRE 요소로 전사 효율 향상.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0254 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

  • mmu-miR-3102-3p

디자인 형식

  • Tough Decoy (TuD)

품질 등급

  • 200

제품 라인

  • MISSION®

형태

  • Liquid

농도

  • ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

GAGCACCCCAUUGGCUACCCACA

Sanger 성숙/소수 수납 번호

저장 온도

  • −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles that transduce mammalian cells efficiently.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression delivered by lentiviral vectors.
The vector also includes a puromycin resistance gene for cell selection.


주요 특징

  • Potent inhibition of target miRNA
  • Efficient lentiviral delivery across various cell types
  • Long-term inhibition without repeat transfection

Merck Sigma 상품 둘러보기

전체보기

문의

0개

아직 등록된 문의가 없어요.