CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

Tough Decoy(TuD) 디자인 기반의 렌티바이러스형 microRNA 억제제. 다양한 세포에 효율적 전달 가능하며 장기적 miRNA 억제 유지. puromycin 내성 유전자를 포함하여 세포 선택 용이. −70°C 보관.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0220 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-299a-5p

Tough Decoy (TuD) 기반 설계


제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNA regulate gene expression via translational repression, mRNA cleavage, and deadenylation.

The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced expression and carries a puromycin resistance gene for selection.


주요 특징

  • 강력한 miRNA 억제 효과
  • 다양한 세포 유형에 효율적 렌티바이러스 전달
  • 반복 형질감염 없이 장기적 억제 유지
  • puromycin 내성 유전자를 통해 안정적 세포 선택 가능

제품 사양

항목 내용
Quality Level 200
제품 라인 MISSION®
Form Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 UGGUUUACCGUCCCACAUACAU
Sanger 성숙/소수 수납 번호 MIMAT0000377
저장 온도 −70°C

제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0개

아직 등록된 문의가 없어요.