
Merck MISSION Lenti microRNA Inhibitor, Mouse
Tough Decoy(TuD) 디자인 기반의 렌티바이러스형 microRNA 억제제. 다양한 세포에 효율적 전달 가능하며 장기적 miRNA 억제 유지. puromycin 내성 유전자를 포함하여 세포 선택 용이. −70°C 보관.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-299a-5p
Tough Decoy (TuD) 기반 설계
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNA regulate gene expression via translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced expression and carries a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효과
- 다양한 세포 유형에 효율적 렌티바이러스 전달
- 반복 형질감염 없이 장기적 억제 유지
- puromycin 내성 유전자를 통해 안정적 세포 선택 가능
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| Form | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGGUUUACCGUCCCACAUACAU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000377 |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



