
Merck MISSION Lenti microRNA Inhibitor, Mouse
포유류 세포 내 miRNA 기능 억제를 위한 렌티바이러스 기반 억제제. Tough Decoy(TuD) 설계로 강력한 억제 효과 제공. 다양한 세포 유형에 효율적 전달 가능. 퓨로마이신 내성 유전자로 안정적 선별 가능. 장기적 miRNA 억제 유지.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-3096a-3p
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UGGGUUAAAGGAUUUACCUGAGGCCA |
| miRBase 접근 번호 | MIMAT0014914 |
| 저장 온도 (Storage Temperature) | −70 °C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design to achieve potent and specific inhibition of target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력하고 선택적인 miRNA 억제 가능
- 렌티바이러스 전달 방식으로 다양한 세포주에 효율적 적용
- 반복 형질감염 없이 장기적 억제 유지
- 퓨로마이신 내성 유전자를 통한 안정적 세포 선별 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



