Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

• mmu-miR-28a-3p

디자인

• Tough Decoy (TuD)

품질 등급

• 200 (M-Clarity Program)

제품 라인

• MISSION®

제형

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• CACUAGAUUGUGAGCUGCUGGA

Sanger 성숙/소수 수납 번호

• MIMAT0004661

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids yields viral particles suitable for mammalian cell transduction.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection.

주요 특징

• 목표 miRNA의 강력한 억제 가능
• 다양한 세포 유형에 효율적으로 전달되는 렌티바이러스 포맷
• 반복 형질감염 없이 장기적 억제 유지
• 퓨로마이신 선택 마커 포함