Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-299a-3p

설계 방식

• Tough Decoy (TuD) 알고리즘 기반
• Haraguchi, T. 및 도쿄대 Hideo Iba 박사와의 협력 연구에 기반한 독자적 설계

제품 라인

• MISSION®

품질 등급

• 200 (M-Clarity Program)

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UAUGUGGGACGGUAAACCGCUU

상거(Sanger) 성숙/소수 수납 번호

• MIMAT0004577

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the Tough Decoy (TuD) design.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The inhibitors are cloned into the TRC2-pLKO-puro lentiviral vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.

The vector includes:

• WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
• Puromycin resistance gene for cell selection

주요 특징

• 목표 miRNA의 강력한 억제 가능
• 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입
• 반복적인 트랜스펙션 없이 장기적 억제 유지 가능