CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-299a-3p 억제를 위한 렌티바이러스 기반 microRNA 저해제. Tough Decoy(TuD) 설계로 강력한 억제 효과 제공. 다양한 세포에 효율적 전달 가능. 장기적 억제 유지 및 퓨로마이신 선택 마커 포함.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0215 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

  • mmu-miR-299a-3p

설계 방식

  • Tough Decoy (TuD) 알고리즘 기반
  • Haraguchi, T. 및 도쿄대 Hideo Iba 박사와의 협력 연구에 기반한 독자적 설계

제품 라인

  • MISSION®

품질 등급

  • 200 (M-Clarity Program)

형태

  • Liquid

농도

  • ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

  • UAUGUGGGACGGUAAACCGCUU

상거(Sanger) 성숙/소수 수납 번호

저장 온도

  • −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the Tough Decoy (TuD) design.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The inhibitors are cloned into the TRC2-pLKO-puro lentiviral vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.

The vector includes:

  • WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
  • Puromycin resistance gene for cell selection

주요 특징

  • 목표 miRNA의 강력한 억제 가능
  • 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입
  • 반복적인 트랜스펙션 없이 장기적 억제 유지 가능

Merck Sigma 상품 둘러보기

전체보기

문의

0개

아직 등록된 문의가 없어요.