Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

mmu-miR-195a-3p

Design

Tough Decoy (TuD)

제품 라인

MISSION®

품질 등급

200 (M-Clarity Program)

형태

Liquid

농도

≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

CCAAUAUUGGCUGUGCUGCUCC

Sanger 성숙/소수 수납 번호

MIMAT0017000

저장 온도

−70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design to effectively inhibit target miRNA activity.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression, and the vector carries a puromycin resistance gene for selection.

주요 특징

• 강력한 miRNA 억제 효과
• 다양한 세포 유형에 효율적 전달
• 반복적인 트랜스펙션 없이 장기적 억제 가능
• Puromycin 저항성 유전자를 통한 선택 가능