
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-195a-3p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. 효율적인 세포 내 전달 및 장기적 억제 가능. TRC2-pLKO-puro 벡터 사용, puromycin 선택 가능. −70°C에서 보관.
- 카탈로그번호
- MLTUD0154
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
mmu-miR-195a-3p
Design
Tough Decoy (TuD)
제품 라인
MISSION®
품질 등급
200 (M-Clarity Program)
형태
Liquid
농도
≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
CCAAUAUUGGCUGUGCUGCUCC
Sanger 성숙/소수 수납 번호
저장 온도
−70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design to effectively inhibit target miRNA activity.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression, and the vector carries a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효과
- 다양한 세포 유형에 효율적 전달
- 반복적인 트랜스펙션 없이 장기적 억제 가능
- Puromycin 저항성 유전자를 통한 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



