Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-190a-3p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스 miRNA 억제제. Lentiviral vector를 이용해 다양한 세포에 효율적으로 전달 가능. 장기적인 miRNA 억제 효과 제공. Puromycin 선택 마커 및 WPRE 포함.
- 카탈로그번호
- MLTUD0108
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 miRNA
- mmu-miR-190a-3p
디자인 유형
- Tough Decoy (TuD)
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | ACUAUAUAUCAAGCAUAUUCCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0016998 |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi, T. This algorithm utilizes the Tough Decoy (TuD) design for potent miRNA inhibition.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- Lentiviral delivery로 다양한 세포에 효율적 전달 가능
- 반복적인 트랜스펙션 없이 장기적 억제 유지 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.