
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 유래 miRNA 억제를 위한 렌티바이러스 기반 억제제. Tough Decoy(TuD) 설계로 강력한 miRNA 억제 가능. 다양한 세포주에 효율적 전달 및 장기적 억제 유지. 퓨로마이신 내성 유전자로 세포 선별 용이.
- 카탈로그번호
- MLTUD0104
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target miRNA: mmu-miR-1843a-3p
Design Type: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 (Quality Level) | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UCUGAUCGUUCACCUCCAUACA |
| Sanger 성숙/소수 수납 번호 | MIMAT0014806 |
| 저장 온도 (Storage Temperature) | −70 °C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design to achieve potent and specific inhibition of target miRNA.
miRNAs regulate gene expression through various mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced expression of transgenes and carries a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력하고 특이적인 miRNA 억제 가능
- 렌티바이러스 기반 전달로 다양한 세포주에 효율적 적용
- 반복 형질감염 없이 장기적 억제 유지
- 퓨로마이신 내성 유전자를 통한 세포 선별 용이
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



