
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor로 특정 miRNA를 강력히 억제 Lentiviral 전달 형식으로 다양한 세포에 효율적 도입 가능 TuD 디자인 기반으로 장기적 억제 효과 제공 puromycin 저항 유전자 포함으로 안정적 세포 선택 가능
- 카탈로그번호
- MLTUD0188
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-1966-5p
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 (Quality Level) | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | AAGGGAGCUGGCUCAGGAGAGAGUC |
| Sanger 성숙/소수 수납 번호 | MIMAT0009439 |
| 저장 온도 (Storage Temperature) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of the target miRNA.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) enhances transgene expression.
The vector includes a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- Potent inhibition of the desired miRNA
- Efficient lentiviral delivery into various cell types
- Long-term inhibition without repeat transfection
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



