
Merck MISSION Lenti microRNA, Mouse
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA, Mouse
mmu-miR-6370
Quality Level
제품 라인
MISSION®
form
liquid
농도
≥1x106 VP/ml (via p24 assay)
성숙 서열
GCAGGAACAGCAAAGGGGAAG
상거(Sanger) 성숙/소수 수납 번호
상거 microRNA 수납 번호
배송 상태
dry ice
저장 온도
−70°C
Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
🏷️Merck Sigma 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 | 
  | 교환/반품 배송비 | 
  | 
|---|---|---|---|
| 착불 배송비 | 
  | ||
| 교환/반품 배송비 | 
  | ||
결제 및 환불 안내
| 결제수단 | 
  | 
|---|---|
| 취소 | 
  | 
| 반품 | 
  | 
| 환급 | 
  | 
교환 및 반품 접수
| 교환 및 반품 접수 기한 | 
  | 
|---|---|
| 교환 및 반품 접수가 가능한 경우 | 
  | 
| 교환 및 반품 접수가 불가능한 경우 | 
  | 
교환 및 반품 신청
| 교환 절차 | 
  | 
|---|---|
| 반품 절차 | 
  | 





