
Merck MISSION Lenti microRNA, Human
인간 microRNA 발현용 렌티바이러스 벡터로, 정확한 Dicer 처리 구조를 갖춘 MISSION® 백본 기반. TRC2-pLKO-puro 벡터에 클로닝되어 서열 검증 완료. 비분열 세포 포함 다양한 세포주 감염 가능하며, 퓨로마이신 선택 마커 포함.
- 브랜드
- Merck Sigma
- 카테고리
- Vectors
Merck Sigma · Merck MISSION Lenti microRNA, Human
MISSION® Lenti microRNA, Human
hsa-miR-124-3p
제품 개요
Sigma의 MISSION® Lenti-miRs는 정확한 Dicer 처리를 위한 구조를 갖춘 공통 백본에서 microRNA를 발현하는 렌티바이러스 기반 시스템입니다.
TRC2-pLKO-puro 벡터에 microRNA 서열이 클로닝되어 있으며, 각 miRNA construct는 클로닝 및 서열 검증을 거쳤습니다. 성숙 microRNA 서열은 miRBase에서 확보됩니다.
이 시스템은 다음과 같은 특징을 가집니다:
- 렌티바이러스 입자는 서열 검증된 플라스미드 벡터로부터 생산됨
- EF1A 프로모터를 사용하여 안정적인 miRNA 발현 유도
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element(WPRE)를 포함하여 발현 효율 향상
- 퓨로마이신 내성 유전자를 포함하여 세포 선택 가능
- 분열 및 비분열 세포(예: 뉴런, 수지상세포) 모두에 감염 및 통합 가능
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥ 1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UAAGGCACGCGGUGAAUGCC |
| Sanger 성숙/소수 수납 번호 | MIMAT0000422 |
| microRNA 수납 번호 | MI0000443 |
| 배송 상태 (Shipping Condition) | Dry ice |
| 저장 온도 (Storage Temperature) | −70°C |
추가 정보
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells.
The polymerase II promoter, elongation factor 1 alpha (EF1A), drives miRNA expression necessary for reverse transcription of viral RNA and integration into the host genome. The Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression. Lentiviral-based particles allow efficient infection and integration into both dividing and non-dividing cells, such as neurons and dendritic cells.
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



