
Merck MISSION Lenti microRNA, Human
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
MISSION® Lenti microRNA, Human
hsa-miR-124-3p
Quality Level
제품 라인
MISSION®
form
liquid
농도
≥1x106 VP/ml (via p24 assay)
성숙 서열
UAAGGCACGCGGUGAAUGCC
상거(Sanger) 성숙/소수 수납 번호
상거 microRNA 수납 번호
배송 상태
dry ice
저장 온도
−70°C
Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
🏷️Merck Sigma 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요

Merck Sigma
Merck MISSION Lenti microRNA, Human
981,060원

Merck Sigma
Merck MISSION Lenti microRNA, Mouse
981,060원

Merck Sigma
Merck MISSION Lenti microRNA, Human
981,060원

Merck Sigma
Merck MISSION TRC2 pLKO.5-puro Non-Target shRNA Control Plasmid DNA
591,000원

Merck Sigma
Merck PSF-CMV-PURO-COOH-TEV-MBP - C-TERMINAL MBP TAG MAMMALIAN PLASMID
856,850원
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|
