다른 상품 둘러보기
MISSION® Lenti microRNA, Human
hsa-miR-106b-5p
Quality Level
제품 라인
MISSION®
form
liquid
농도
≥1x106 VP/ml (via p24 assay)
성숙 서열
UAAAGUGCUGACAGUGCAGAU
상거(Sanger) 성숙/소수 수납 번호
상거 microRNA 수납 번호
배송 상태
dry ice
저장 온도
−70°C
Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
배송/결제/교환/반품 안내
배송 정보
기본 배송비 |
| 교환/반품 배송비 |
|
---|---|---|---|
착불 배송비 |
| ||
교환/반품 배송비 |
|
결제 및 환불 안내
결제 방법 |
|
---|---|
취소 |
|
반품 |
|
환급 |
|
교환 및 반품 접수
교환 및 반품 접수 기한 |
|
---|---|
교환 및 반품 접수가 가능한 경우 |
|
교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
교환 절차 |
|
---|---|
반품 절차 |
|