Thermo Fisher Scientific M13/pUC Sequencing Primer (-46), 22-mer
다른 상품 둘러보기
Thermo Scientific™
M13/pUC Sequencing Primer (-46), 22-mer
Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5- and 3
-hydroxyl ends. This자세히 알아보기
Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5- and 3
-hydroxyl ends. This M13/pUC primer anneals to the region in the 5`-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5-d(GCCAGGGTTTTCCCAGTCACGA)-3
사양
제품 유형Sequencing Primer
배송 조건Dry Ice
농도10 μM
PrimerM13
수량10 μM, 45 μL
벡터pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
용도(애플리케이션)Sequencing
형태Liquid
Unit Size10 µM
배송/결제/교환/반품 안내
배송 정보
기본 배송비 |
| 교환/반품 배송비 |
|
---|---|---|---|
착불 배송비 |
| ||
교환/반품 배송비 |
|
결제 및 환불 안내
결제수단 |
|
---|---|
취소 |
|
반품 |
|
환급 |
|
교환 및 반품 접수
교환 및 반품 접수 기한 |
|
---|---|
교환 및 반품 접수가 가능한 경우 |
|
교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
교환 절차 |
|
---|---|
반품 절차 |
|