
Thermo Fisher Scientific T3 RNA Polymerase (20 U/μL)
✨AI 추천 연관 상품
AI가 분석한 이 상품과 연관된 추천 상품들을 확인해보세요
연관 상품을 찾고 있습니다...
Thermo Scientific™
T3 RNA Polymerase (20 U/μL)
Thermo Scientific Bacteriophage T3 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It자세히 알아보기
Thermo Scientific Bacteriophage T3 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5→3 synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter and is able to incorporate modified nucleotide.
Highlights
• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)
Applications
• Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing
Note
Consensus promoter sequence:
T3: AATTAACCCTCACTAAAGGGAGA
The position in bold (+1) indicates the first nucleotide incorporated into RNA during transcription. Only bases at this position through +3 are critical for transcription, and they must be a G and a purine base, respectively.
사양
중합효소T3 RNA Polymerase
수량2,000 units
농도20U/µL
Unit SizeEach
🏷️Thermo Fisher Scientific 상품 둘러보기
동일 브랜드의 다른 상품들을 확인해보세요

Thermo Fisher Scientific
Thermo Fisher Scientific T7 RNA Polymerase (20 U/μL), 5,000 units
107,600원

Thermo Fisher Scientific
Thermo Fisher Scientific T3 RNA Polymerase, HC (≥100 U/μL)
232,700원

Thermo Fisher Scientific
Thermo Fisher Scientific T3 RNA Polymerase (20 U/μL)
82,200원

Thermo Fisher Scientific
Thermo Fisher Scientific TheraPure phi29 DNA Polymerase (10 U/μL)
100원

Thermo Fisher Scientific
Thermo Fisher Scientific phi29 DNA Polymerase (10 U/μL), 250 units
102,700원
배송/결제/교환/반품 안내
배송 정보
| 기본 배송비 |
| 교환/반품 배송비 |
|
|---|---|---|---|
| 착불 배송비 |
| ||
| 교환/반품 배송비 |
| ||
결제 및 환불 안내
| 결제수단 |
|
|---|---|
| 취소 |
|
| 반품 |
|
| 환급 |
|
교환 및 반품 접수
| 교환 및 반품 접수 기한 |
|
|---|---|
| 교환 및 반품 접수가 가능한 경우 |
|
| 교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
| 교환 절차 |
|
|---|---|
| 반품 절차 |
|
