Thermo Fisher Scientific T7 Promoter Primer
다른 상품 둘러보기
Invitrogen™
T7 Promoter Primer
Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter Primer자세히 알아보기
Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter Primer is recognized by T7 RNA polymerase and is commonly used to regulate gene expression of recombinant proteins. Subsequent recombinant proteins may be used for further downstream research applications.
T7 Promoter Primer features include:
• Desalted and purified by gel filtration
• Assayed for function by PCR amplification
• Provided in 2 μg quantity
Applications
• Sanger sequencing
• PCR amplification
T7 Primer Sequence: 5´- TAATACGACTCACTATAGGG- 3´
사양
프로모터T7
제품 유형Primer
프라이머 길이20-mer
프라이머 서열5 ́d[TAATACGACTCACTATAGGG]3 ́
정제 방법Gel-purified
배송 조건Room Temperature
PrimerT7
수량2 μg
용도(애플리케이션)PCR Amplification
형태Lyophilized
Unit SizeEach
배송/결제/교환/반품 안내
배송 정보
기본 배송비 |
| 교환/반품 배송비 |
|
---|---|---|---|
착불 배송비 |
| ||
교환/반품 배송비 |
|
결제 및 환불 안내
결제수단 |
|
---|---|
취소 |
|
반품 |
|
환급 |
|
교환 및 반품 접수
교환 및 반품 접수 기한 |
|
---|---|
교환 및 반품 접수가 가능한 경우 |
|
교환 및 반품 접수가 불가능한 경우 |
|
교환 및 반품 신청
교환 절차 |
|
---|---|
반품 절차 |
|