Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral 기반 microRNA 억제제로 다양한 세포에 효율적 전달 가능. Tough Decoy(TuD) 디자인으로 강력한 miRNA 억제 효과 제공. 장기간 안정적인 억제 유지 가능. Puromycin 선택 마커 포함으로 세포 선택 용이.
- 카탈로그번호
- MLTUD0035
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-128-1-5p
Tough Decoy (TuD) 디자인 적용
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CGGGGCCGUAGCACUGUCUGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0016982 |
| microRNA 수납 번호 | MI0000155 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력한 miRNA 억제 효과 제공
- Lentiviral 전달 형식으로 다양한 세포에 효율적 전달 가능
- 반복적인 트랜스펙션 없이 장기간 억제 유지 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.