Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

타깃 microRNA

• mmu-miR-877-3p

디자인

• Tough Decoy (TuD) 기반 설계

품질 등급

• 200

제품 라인

• MISSION®

형태

• 액상 (liquid)

농도

• ≥ 1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UGUCCUCUUCUCCCUCCUCCCA

Sanger 성숙/소수 수납 번호

• MIMAT0004862

microRNA 수납 번호

• MI0005553

배송 상태

• 드라이아이스 (dry ice)

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design. miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.

The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) is included for enhanced transgene expression.
This vector also carries a puromycin resistance gene for cell selection.

주요 특징

• 원하는 miRNA의 강력한 억제 가능
• 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달
• 반복적인 트랜스펙션 없이 장기적 억제 가능