Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-544-3p 표적 억제를 위한 렌티바이러스 기반 microRNA Inhibitor. Tough Decoy(TuD) 설계로 강력하고 지속적인 miRNA 억제 가능. 다양한 세포에 효율적 전달. 퓨로마이신 선택 마커 포함. −70°C에서 보관.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-544-3p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles for efficient transduction of mammalian cells.
This vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
- Puromycin resistance gene for cell selection
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달
- 반복적인 트랜스펙션 없이 장기적인 억제 가능
제품 사양
| 항목 | 내용 |
|---|---|
| 제품 라인 | MISSION® |
| 품질 등급 | 200 |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AUUCUGCAUUUUUAGCAAGCUC |
| Sanger 성숙/소수 수납 번호 | MIMAT0004941 |
| microRNA 수납 번호 | MI0005555 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.