Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-208b-5p 억제를 위한 Tough Decoy(TuD) 디자인 기반 렌티바이러스형 microRNA inhibitor. 효율적인 세포 전달 및 장기적 억제 가능. TRC2-pLKO-puro 벡터 기반으로 퓨로마이신 선택 가능. −70°C 보관, 드라이아이스 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-208b-5p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to efficiently inhibit target miRNA activity.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles that can transduce mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- Potent inhibition of the desired miRNA
- Lentiviral delivery enables efficient transduction into various cell types
- Long-term inhibition without repeat transfection
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AAGCUUUUUGCUCGCGUUAUGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0017280 |
| microRNA 수납 번호 | MI0005552 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.